View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_high_63 (Length: 203)
Name: NF17861_high_63
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 81 - 191
Target Start/End: Original strand, 47321319 - 47321430
Alignment:
| Q |
81 |
ttctccaattgttccagcttcttcgatctttctgtgtcagcttcacctgttccaactcttacagctttgaaaagcttcaatatttct-aaaattccatca |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
47321319 |
ttctccaattgttccagcttcttcgatctttctgtgtcagcttcacctgttccaactcttacagctttgaaaagcttcaatatttctaaaaaatccatca |
47321418 |
T |
 |
| Q |
180 |
ttcttctcactc |
191 |
Q |
| |
|
||||| |||||| |
|
|
| T |
47321419 |
ttcttttcactc |
47321430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University