View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_low_33 (Length: 353)
Name: NF17861_low_33
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 91 - 338
Target Start/End: Original strand, 9168018 - 9168265
Alignment:
| Q |
91 |
ttcaatgaacgtgatcgtactcgaatcaaacgagtgagggtggtgccacaggtggagcatttagagcgatttttcgccatggttttgccgcaggttgaac |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9168018 |
ttcaatgaacgtgatcgtactcgaatcaaacgagtgagggtggtgccacaggtggagcatttagagcgatttttcgccatggttttgccgcaggttgaac |
9168117 |
T |
|
| Q |
191 |
aaagagtcatgtgcttgcaattgcttccgtagagacaggtggttacaccgcatccgcaacaggatgatttcaaaggcaggttcatcgtcgttgttgttga |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
9168118 |
aaagagtcatgtgcttgcaattgcttccgtagagaccggtggttacaccgcatccgcaacaggatgatttcaattgcaggttcatcgttgttgttgttga |
9168217 |
T |
|
| Q |
291 |
atctttacgacggagaatgagatttatgattcgattaacgaaggaatt |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9168218 |
atctttacgacggagaatgagatttatgattcgattaacgaaggaatt |
9168265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 108 - 338
Target Start/End: Original strand, 9156378 - 9156607
Alignment:
| Q |
108 |
tactcgaatcaaacgagtgagggtggtgccacaggtggagcatttagagcgatttttcgccatggttttgccgcaggttgaacaaagagtcatgtgcttg |
207 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||| |||| | |||| ||||| ||||||| |
|
|
| T |
9156378 |
tactcgaatcaaacgagtgagcaacgcgccacaggtggagcatttagagcgattttccgccatggttttgccacagggggcgcaaatagtcaagtgcttg |
9156477 |
T |
|
| Q |
208 |
caattgcttccgtagagacaggtggttacaccgcatccgcaacaggatgatttcaaaggcaggttcatcgtcgttgttgttgaatctttacgacggagaa |
307 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| ||| |||||||| | || | ||| ||||||||| ||||||||| || ||||| |
|
|
| T |
9156478 |
caattgcttccgtagagaccggtggtttcaccgcatccgctacaactggatttcaattgaagatccattatcgttgttg-tgaatcttttcgctggagat |
9156576 |
T |
|
| Q |
308 |
tgagatttatgattcgattaacgaaggaatt |
338 |
Q |
| |
|
||||||||||||| |||| |||| ||||||| |
|
|
| T |
9156577 |
tgagatttatgatacgataaacgtaggaatt |
9156607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University