View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_low_40 (Length: 321)
Name: NF17861_low_40
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 19 - 317
Target Start/End: Original strand, 25526042 - 25526342
Alignment:
| Q |
19 |
caaaatataatctgtcattacattgtgctttttgccaccaacagatgctgcctgtagaatcaaatcaatttcagaacaca--gtatttatgatgcatgca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
25526042 |
caaaatataatctgtcattacattgtgctttttgccaccaacagatgctgcctgtagagtcaaatcaatttcagaacacaaagtatttaggatgcatgca |
25526141 |
T |
 |
| Q |
117 |
tgcatcatttaattttcatatacatttgcaaccaaccttcataaatgcatcaatttctggacttggcatcaccnnnnnnnccttttctaagctttccaga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25526142 |
tgcatcatttaattttcatatacatttgcaaccaaccttcataaatgcatcaatttctggacttggcatcacctttttttccttttctaagctttccaga |
25526241 |
T |
 |
| Q |
217 |
tttttcaataactctgattaagaaattaaatgatttaatttagttcagaaatttgatttagattaaaaatgaatataataaaggtaatagtataatctac |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
25526242 |
tttttcaataactctgattaagaaattaaatgatttaatttagttcagaaatttgatttagattaaaaatgaatataataaaggtaatattataatgtac |
25526341 |
T |
 |
| Q |
317 |
c |
317 |
Q |
| |
|
| |
|
|
| T |
25526342 |
c |
25526342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University