View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_low_41 (Length: 320)
Name: NF17861_low_41
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 14 - 150
Target Start/End: Complemental strand, 25526658 - 25526522
Alignment:
| Q |
14 |
gcataggatgacattgttattaggacctccaggatctggaaaatctactttacttttggctcttgctggaaaacttgcaagtaacctcaaggtaactaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25526658 |
gcataggatgacattgttattaggacctccaggatctggaaaatctactttacttttggctcttgctggaaaacttgcaagtaacctcaaggtaactaac |
25526559 |
T |
|
| Q |
114 |
tacatattctaaacagaactgtaagaagcatggttgg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25526558 |
tacatattctaaacagaactgtaagaagcatggttgg |
25526522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University