View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_low_43 (Length: 300)
Name: NF17861_low_43
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_low_43 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 14 - 300
Target Start/End: Complemental strand, 38559261 - 38558975
Alignment:
| Q |
14 |
tactgctatatataggtgaggtaaaatagatatagataacgtgaaaaggaagctgcatggaaacttccttcctctttgatatatagatagccggcgtgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38559261 |
tactgctatatataggtgaggtaaaatagatatagataacgtgaaaaggaagctgcatggaaacttccttcctcattgatatatagatagccggcgtgat |
38559162 |
T |
 |
| Q |
114 |
taaggatagagatgttttggaattatttcaatatcatcactataacttaggtttcctcgtaaatgcttggattattaggtatagacattcatacaactat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38559161 |
taaggatagagatgttttggaattatttcaatatcatcactataacttaggtttcctcgttaatgcttggattattaggtatagacattcatacaactat |
38559062 |
T |
 |
| Q |
214 |
gttcttaacgaaccgcctcatatactgtcacagctcacattgctgccataatcatacaccacacagcacagataaataaataaattc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38559061 |
gttcttaacgaaccgcctcatatactgtcacagctcacattgctgccataatcatataccacacagcacagataaataaataaattc |
38558975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University