View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_low_52 (Length: 251)
Name: NF17861_low_52
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_low_52 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 145985 - 146215
Alignment:
| Q |
10 |
attattctctcatcttaatttgtagtagaaaatgaaaaagagtcactgttccatttaattttacttagattttttatatgggttaaaaatttactttggt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
145985 |
attattctctcatcttaatttgtagtagaaaatgaaaaagagtcactgttccatttaattttacttagattttttatatgggttaaaaatttactttggt |
146084 |
T |
|
| Q |
110 |
ggatgtattgtgatgttgtctctttacaaaaagtgatgatgataacgtgagcaccgaccagtagggaacttcacgcatttctcacttccgtaaactgaaa |
209 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
146085 |
g-----------atgttgtctctttacaaaaagtgatgatgataacgtgagcaccggccagtagggaacttcacgcatttctcacttccttaaactgaaa |
146173 |
T |
|
| Q |
210 |
ctgaaatgttgtttgatgttagatggatagatgttgttggtc |
251 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
146174 |
ctgaaatgttgtttaatgttagatggatagatgttgttggtc |
146215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University