View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_low_54 (Length: 250)
Name: NF17861_low_54
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_low_54 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 52 - 250
Target Start/End: Original strand, 7017087 - 7017285
Alignment:
| Q |
52 |
gcctgtctcgtagcgaattccagctgagccagatgcatagttaacacctttcaatatgtcccagccagcaaggcttgcaaagggagggatgaaatctaat |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7017087 |
gcctgtctcgtagcgaattccagctgagccagatgcatagttaacacctttcaatatatcccagccagcaaggcttgcaaagggtgggatgaaatctaat |
7017186 |
T |
 |
| Q |
152 |
cccaaaagttgacctgcaaattaatggtcaaacattagtttgagttgaacaagaagttttattagatttaaaaattgaacctgaaaatattttaagacc |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7017187 |
cccaaaagttgacctgaaaattaatggtcaaacattagtttgagttgaacaagaagttttattagatttaaaaattgaacctgagaatattttaagacc |
7017285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 102
Target Start/End: Original strand, 5558826 - 5558864
Alignment:
| Q |
64 |
gcgaattccagctgagccagatgcatagttaacaccttt |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5558826 |
gcgaattccagctgcaccagatgcatagttaacaccttt |
5558864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 111
Target Start/End: Original strand, 5576323 - 5576369
Alignment:
| Q |
65 |
cgaattccagctgagccagatgcatagttaacacctttcaatatgtc |
111 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| | |||||| |
|
|
| T |
5576323 |
cgaattccagctgcaccagatgcatagttaacacctttgagtatgtc |
5576369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University