View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17861_low_62 (Length: 225)

Name: NF17861_low_62
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17861_low_62
NF17861_low_62
[»] scaffold0004 (1 HSPs)
scaffold0004 (8-207)||(222730-222929)


Alignment Details
Target: scaffold0004 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 8 - 207
Target Start/End: Complemental strand, 222929 - 222730
Alignment:
8 gagtgagatgaagaggttatggattgaatattttttatggaggtttgggaggttttctttttcgtaaccgagtgagagaggggtgggaaagtttggtttt 107  Q
    |||||| | ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||    
222929 gagtgaaaggaagatgttatggattgaatattttttatggaggtttgagaggttttctttttcgtaactgagtgagagaggggtgggaaagtttggtttt 222830  T
108 aaatgaatggtcatgatgcaataaagtgatttgatttagatgattcaattcagttttcgtattgaatctatttgaatcgattcaaaaggaaggtttttca 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
222829 aaatgaatggtcatgatgcaataaagtgatttgatttagatgattcaattcagttttcgtattgaatctatttgaatcgattcaaaaggaaggtttttca 222730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University