View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17862_high_18 (Length: 243)
Name: NF17862_high_18
Description: NF17862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17862_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 225
Target Start/End: Original strand, 36969416 - 36969642
Alignment:
| Q |
4 |
tagtacatgtatgccagtttgttgataaaacttttcattgttcctgactagctaaaatttatatacttgtattttgattataaactatggttatatatct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36969416 |
tagtacatgtatgccagtttgttgataaaacttttcattgttcctgactagctacaatttatatacttgtattttgattataaactatggttatatatct |
36969515 |
T |
 |
| Q |
104 |
gcagatatatacactcactgaggccaggactata-taaccgtttgggagaggtaaaattaatcacaagcataatcaaacgcatcaataaacattgcaatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36969516 |
gcagatatatacactcactgaggccaggactatattaaccgtttgggagaggtaaaattaatcacaagcataatcaaacgcatcaataaacattgcaatt |
36969615 |
T |
 |
| Q |
203 |
----aatcaatcttataatgggttgga |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36969616 |
aatcaatcaatcttataatgggttgga |
36969642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University