View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17862_high_20 (Length: 241)
Name: NF17862_high_20
Description: NF17862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17862_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 24 - 133
Target Start/End: Complemental strand, 14354727 - 14354618
Alignment:
| Q |
24 |
atacattatttagtagttatggaatgttttgattaatgcataaccgcaacctataacacgacattcgtaacagtcaaaatcgtaaaatcatacatatatg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
14354727 |
atacattatttagtagttatggaatgttttgattaatgcataaccgtaatctataacacgacattcgtaacagtcaaaatcgtgaaatcctacatatatg |
14354628 |
T |
 |
| Q |
124 |
tgacaacgat |
133 |
Q |
| |
|
||||||||| |
|
|
| T |
14354627 |
cgacaacgat |
14354618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University