View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17862_low_14 (Length: 316)
Name: NF17862_low_14
Description: NF17862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17862_low_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 18 - 316
Target Start/End: Complemental strand, 1656998 - 1656698
Alignment:
| Q |
18 |
agttcccacctttaagttttctgatcaaaacaagaaacaaggtttcatttatgcccaattacaaaataatttgaaagagctaggaattaaatactaacct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1656998 |
agttcccacctttaagttttctgatcaaaacaagaaacaaggtttcatttatgcccaattacaaaataatttgaaagagctaggaattaaatactaacct |
1656899 |
T |
 |
| Q |
118 |
taggccattatgttttaatatttgtaacatacttgagtagcatgtcaacaacttctgttgagacctttgaacctgattgctttaagtctccaatcttagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1656898 |
taggccattatgttttaatatttgtaacatacttgagtagcatgtcaacaacttctgttgagacctttgaacctgattgctttaagtctccaatcttagt |
1656799 |
T |
 |
| Q |
218 |
atctgtctcttgatcaagcctttttacatttaatccagagctcccagttgtctaaggaaa--ctcaatcaataccaaataattacactgaattatatgat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1656798 |
atctgtctcttgatcaagcctttttacatttaatccagagctcccagttgtctaaggaaactctcaatcaataccaaataattacactgaattatgtgat |
1656699 |
T |
 |
| Q |
316 |
t |
316 |
Q |
| |
|
| |
|
|
| T |
1656698 |
t |
1656698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University