View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17862_low_27 (Length: 210)
Name: NF17862_low_27
Description: NF17862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17862_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 8445885 - 8445695
Alignment:
| Q |
16 |
atatgctctataaactgcatttatttggttgttatgaattatatcaatttatttttcgaagttgaaaactacctttagacatcaaaacaactctctctac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8445885 |
atatgctctataaactgcatttatttggttgttatgaattatatcaacttatttttcgaagttgaaaactacctttagacatcaaaacaactttctctac |
8445786 |
T |
|
| Q |
116 |
attaaccaatacatgaagtttaggaattgtgataacctatcta----taatacgctcatgtcatcacaatatccacattcacaatattctt |
202 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8445785 |
gttaatcaataaatgaagtttaggaattgtgataacctatctatctgtaatatgctcatgtcatcacaatattcacattcacaatattctt |
8445695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University