View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17862_low_28 (Length: 205)
Name: NF17862_low_28
Description: NF17862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17862_low_28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 40001152 - 40001346
Alignment:
| Q |
11 |
gagaagaaattacaggatgcaataacccttttatttattatgatagaactgttgaggcaacatatgagatacgtgagaacccataataaatggagagata |
110 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40001152 |
gagaagaaattacaggatgcaacaacccttttatttattatgatagaactgttgaggcaacatatgacatacgtgagaacccataataaatggagagata |
40001251 |
T |
 |
| Q |
111 |
gacacatttgtgcttaatttgtttcatatccttcgaaagataaatatgagcttttagaggttgacatggctaagaaaatggcaaagaaaatatgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40001252 |
gacacatttgtgcttaatttgtttcatatccttcgaaatataaatatgagcttttagaagttgacatggctaagaaaatggcaaagaaaatatgg |
40001346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 162 - 205
Target Start/End: Complemental strand, 49385571 - 49385528
Alignment:
| Q |
162 |
ttttagaggttgacatggctaagaaaatggcaaagaaaatatgg |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49385571 |
ttttagaggttgacatggctgagaaaatggcaaagaaaatatgg |
49385528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University