View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17862_low_28 (Length: 205)

Name: NF17862_low_28
Description: NF17862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17862_low_28
NF17862_low_28
[»] chr1 (1 HSPs)
chr1 (11-205)||(40001152-40001346)
[»] chr4 (1 HSPs)
chr4 (162-205)||(49385528-49385571)


Alignment Details
Target: chr1 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 40001152 - 40001346
Alignment:
11 gagaagaaattacaggatgcaataacccttttatttattatgatagaactgttgaggcaacatatgagatacgtgagaacccataataaatggagagata 110  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
40001152 gagaagaaattacaggatgcaacaacccttttatttattatgatagaactgttgaggcaacatatgacatacgtgagaacccataataaatggagagata 40001251  T
111 gacacatttgtgcttaatttgtttcatatccttcgaaagataaatatgagcttttagaggttgacatggctaagaaaatggcaaagaaaatatgg 205  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
40001252 gacacatttgtgcttaatttgtttcatatccttcgaaatataaatatgagcttttagaagttgacatggctaagaaaatggcaaagaaaatatgg 40001346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 162 - 205
Target Start/End: Complemental strand, 49385571 - 49385528
Alignment:
162 ttttagaggttgacatggctaagaaaatggcaaagaaaatatgg 205  Q
    |||||||||||||||||||| |||||||||||||||||||||||    
49385571 ttttagaggttgacatggctgagaaaatggcaaagaaaatatgg 49385528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University