View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17862_low_9 (Length: 448)
Name: NF17862_low_9
Description: NF17862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17862_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 155 - 433
Target Start/End: Complemental strand, 50644845 - 50644567
Alignment:
| Q |
155 |
aaatttcgaaagctcttttcaataaccgcttgattttaaatgcataactctacactcacagtaacgaaccttctccctgtctttcctctgcaaggtttta |
254 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50644845 |
aaatctcgaaagctcttttcaataaccgcttgattttaaatgcataactctacattcacagtaacgaaccttctccctgtctttcctctgcaaggtttta |
50644746 |
T |
|
| Q |
255 |
ctaaggtattgagttttgtttaggaagagagtnnnnnnnntacatgtgttaccttcatagcagatgatttgttgagttatcagaccttttcttaacttct |
354 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50644745 |
ctaaggtattgggttttgtttaggaagagagtgaaaaaaatacatgtgttaccttcatagcagatgatttgttgagttatcagaccttttcttaacttct |
50644646 |
T |
|
| Q |
355 |
gttggagctgatgattctatcttaatattcatagtttacttgtatttcccctcttcttcacaaaagaaactcaggttct |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50644645 |
gttggagctgatgattctatcttaatattcatagtttacttgtatttcccctcttcttcacaaaagaaactcaggttct |
50644567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 336 - 366
Target Start/End: Original strand, 12048245 - 12048275
Alignment:
| Q |
336 |
agaccttttcttaacttctgttggagctgat |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12048245 |
agaccttttcttaacttctgttggagctgat |
12048275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University