View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17863_high_14 (Length: 233)
Name: NF17863_high_14
Description: NF17863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17863_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 7541298 - 7541452
Alignment:
| Q |
1 |
ttgcacttgtgccgcgtaggggtctacacatgcccacatgcctcttttaaacatatggcattgttttttcggtcagtgtgcgtgggtgcacacgacaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7541298 |
ttgcacttgtgccgcgtaggggtctacacatgcccacatgcttcttttaaacatatggcattgttttttcggtcggtgtgcgtgggtgcacacgacaatg |
7541397 |
T |
|
| Q |
101 |
tgattctccaactttcacccttcaagccacgtgggactcgaaggtctgtgcgcga |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7541398 |
tgattctccaactttcacccttcaagccacgtgggactcgaaggtctgtgcgcga |
7541452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University