View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17863_high_16 (Length: 225)
Name: NF17863_high_16
Description: NF17863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17863_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 10 - 121
Target Start/End: Complemental strand, 41597697 - 41597586
Alignment:
| Q |
10 |
aagaatatccaaatgctttgcatctccaaaaatacttaatctaaaaaatttagaaaatcatccttatgaaggtaaagatataattatattcagggcctgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41597697 |
aagaatatccaaatgctttgcatctccaaaaatacttaatctaaaaaatttagaaaatcatccttatgaaggtaaagatataattatattcagggcctgc |
41597598 |
T |
 |
| Q |
110 |
aagcccgtggat |
121 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41597597 |
aagcccgtggat |
41597586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 114 - 206
Target Start/End: Complemental strand, 41597409 - 41597316
Alignment:
| Q |
114 |
ccgtggatgatgattcagttgctgcatttaggttgctta-ctttaaattcactcaatagtccaaatgaaaatcaaagttaatatttctaggttg |
206 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41597409 |
ccgtcgatgatgattcagttgctgcatttaggttgcttagctttaaattcactcaatagtccaaatgaaaatcaaagttaatatttctaggttg |
41597316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University