View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17863_low_14 (Length: 241)
Name: NF17863_low_14
Description: NF17863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17863_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 34791865 - 34792079
Alignment:
| Q |
18 |
tttgtgaatcctcacggatttatcatttataaaaaactatctttaacctcaattcatagacatgtgaaattactttactgtgccggaacaatgtgataaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
34791865 |
tttgtgaatcctcacggatttatcatttataaaaaactatctttaacctctattcatagacatgtgaaactactttactgtgccggaacaatgtgataca |
34791964 |
T |
|
| Q |
118 |
ctcgttttcatcttcttctcaattattctaactttttacacagcatccccaaacac-aacttctcacgaactattccaataagattactatgaggaacct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34791965 |
ctcgttttcatcttcttctcaattattctaactttttacacagcatccccaaacacaaagttctcacgaactattccaataagattactatgaggaacct |
34792064 |
T |
|
| Q |
217 |
aaccttgttcctttg |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34792065 |
aaccttgttcctttg |
34792079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University