View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17863_low_17 (Length: 230)
Name: NF17863_low_17
Description: NF17863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17863_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 42272017 - 42271808
Alignment:
| Q |
1 |
taattaatcatatcataaatgaataaaatatcaataaggtcttactttcttccgataagtctcttgacatcaaagatggtcctttcgggattgacagctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272017 |
taattaatcatatcataaatgaataaaatatcaataaggtcttactttcttccgataagtctcttgacatcaaagatggtcctttcgggattgacagctg |
42271918 |
T |
|
| Q |
101 |
ccagattctttgcggcctccccaatcaatctctcatcatcggtgaaagaaacccatgatggtgtgatacggttaccttggtcgttggctatgatttcaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42271917 |
ccagattctttgcggcctccccaatcaatctctcatcatcggtgaaagaaacccatgatggtgtgatacggttaccttggtcgttggctatgatttcaac |
42271818 |
T |
|
| Q |
201 |
atgaccgttc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
42271817 |
atgaccgttc |
42271808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 39 - 203
Target Start/End: Complemental strand, 42324123 - 42323959
Alignment:
| Q |
39 |
gtcttactttcttccgataagtctcttgacatcaaagatggtcctttcgggattgacagctgccagattctttgcggcctccccaatcaatctctcatca |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
42324123 |
gtcttactttcttccgataagtctcttgacatcaaagatggtcctttcagggttgacagctgccagattcttagcagcctctccaatcaatctctcatca |
42324024 |
T |
|
| Q |
139 |
tcggtgaaagaaacccatgatggtgtgatacggttaccttggtcgttggctatgatttcaacatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
42324023 |
tcggtgaaagaaacccatgatggtgtgatacgatttccttggtcgttggctatgatttcaacatg |
42323959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 201
Target Start/End: Original strand, 39987032 - 39987066
Alignment:
| Q |
167 |
tacggttaccttggtcgttggctatgatttcaaca |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
39987032 |
tacggttaccttggtcgttggcgatgatttcaaca |
39987066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University