View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17863_low_2 (Length: 566)
Name: NF17863_low_2
Description: NF17863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17863_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 7e-66; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 7e-66
Query Start/End: Original strand, 381 - 556
Target Start/End: Original strand, 40283407 - 40283582
Alignment:
| Q |
381 |
agctccttttttggcaaagtgattgatgtcatattcttgtttagttttgtggtgagtgaatgatgctacaaaggctgtggtcttgtatttaattgcctca |
480 |
Q |
| |
|
||||||||||||||| |||| ||| |||| || ||||| |||||||||| ||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
40283407 |
agctccttttttggcgaagtaattaatgtgattttcttatttagttttgctatgagtgaatgatgctacaagagcagtggtcttgtatttaattgcctca |
40283506 |
T |
|
| Q |
481 |
tatacttagtcttgtcctggtttgctatgccttgatgagttgttggggactttgaggtattgtatgaatgatgatg |
556 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283507 |
tatacttagtcttgtcctggtttgctatgccttgatgagttgttggggactttgaggtattgtatgaatgatgatg |
40283582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 173 - 262
Target Start/End: Original strand, 40283263 - 40283351
Alignment:
| Q |
173 |
gtatacttaatgtgatgttgctgctaaattttgttttgcagaattagcatttggcagcaaccaataacattggtgtatgtttgttgaaac |
262 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||| ||||| || |||||||| ||||||||||||| ||| ||||||| |
|
|
| T |
40283263 |
gtatagttaatgtgatgttgctgctaaattcagttttgcagaattatcattt-gctgcaaccaaaaacattggtgtatatttcttgaaac |
40283351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 298 - 354
Target Start/End: Original strand, 40283350 - 40283406
Alignment:
| Q |
298 |
actgctgatcctattgtatggtgaagtgcagaactgaaatgttaagagggaatcgtt |
354 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
40283350 |
actgctgattctattgtatggtgaagtgcaggactgaagcattaagagggaatcgtt |
40283406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University