View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17863_low_22 (Length: 208)
Name: NF17863_low_22
Description: NF17863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17863_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 25234439 - 25234612
Alignment:
| Q |
18 |
ccaagtacttggcagcattgcctaaaaataattatgatcgtatatctctcaactataataaactatatctcaattctaaattgtatctaaacagaatttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25234439 |
ccaagtacttggcagcattgcctaaaaataattatgatcgtatatctctcaattataataaacta-atctcaattctaaattgtatctaaacagaatttc |
25234537 |
T |
 |
| Q |
118 |
aattaattatggtagggtgttcacattcaaaatcttccattgtggggggatactttaaaatcttaagacattcat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25234538 |
aattaattatggtagggtgttcacattcaaaatcttccattgtggggggatactttaaaatcttaagacattcat |
25234612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University