View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17864_high_16 (Length: 316)
Name: NF17864_high_16
Description: NF17864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17864_high_16 |
 |  |
|
| [»] scaffold2098 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0247 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0112 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 13)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 7 - 300
Target Start/End: Complemental strand, 40328347 - 40328050
Alignment:
| Q |
7 |
atcaagaaaatgactaatagagttaacgtataacggtccccgtgagtatagttcagttggc----agggacaatacattgttatatgcgagagccgtgga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||| |||||||||||||||||| |||||||||| ||| | |
|
|
| T |
40328347 |
atcaagaaaatgactaatagagttaacgtataacgatccccgtgagcatagctcagttggctggcagggacaatacattgttaaatgcgagagcagtgaa |
40328248 |
T |
 |
| Q |
103 |
ttcgaaacccaaaaatctcacttattcatttataaatcgtagatttagtgtcacagccggtgtgcgtgaaaagcctaatggtttgtgtgagccgcaatta |
202 |
Q |
| |
|
|||||| | |||||| |||||||||||||| || ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40328247 |
ttcgaacctcaaaaacctcacttattcattcatcaatcgtagatttactgtcacagccggtgtgcgcgaaaagcctaatggtttgtgtgagccgcaatta |
40328148 |
T |
 |
| Q |
203 |
gcacatatagtgatgacattataaatgaatggtttatttaaatgagaaaggacaagttaaatgacaatgtcagagtttgtagtcttaagtctcatttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40328147 |
gcacatatagtgatgacattataaatgaatggtttatttaaatgagaaaggacaagttaaatgacaatgtcagagtttgtagtcttaagtctcatttt |
40328050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 20527531 - 20527483
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
20527531 |
gtccctgtgagtatagctcagttggcagggacaatgcattgttatatgc |
20527483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 21285455 - 21285407
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
21285455 |
gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgc |
21285407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 90
Target Start/End: Original strand, 41139079 - 41139128
Alignment:
| Q |
41 |
ggtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
41139079 |
ggtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
41139128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 4169069 - 4169117
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||||||||||| |
|
|
| T |
4169069 |
gtccccgtgagcatagctcagttggcagggacaatgtattgttatatgc |
4169117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 14818467 - 14818419
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| | |||| |||||||| |
|
|
| T |
14818467 |
gtccccgtgagcatagctcagttggcagggacagtgcattattatatgc |
14818419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 15265465 - 15265417
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| | |||| |||||||| |
|
|
| T |
15265465 |
gtccccgtgagcatagctcagttggcagggacagtgcattattatatgc |
15265417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 15912768 - 15912816
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||| |||||||| ||||| ||||||||||||| |
|
|
| T |
15912768 |
gtccccgtgagaatagctcaattggcaggaacaatgcattgttatatgc |
15912816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 45 - 89
Target Start/End: Original strand, 22660737 - 22660781
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatg |
89 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||| |||||||||||| |
|
|
| T |
22660737 |
cccgtgagcatagttcagttgacagggataatgcattgttatatg |
22660781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 29658374 - 29658326
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||| ||||||| |||||| ||||||||||||| |
|
|
| T |
29658374 |
gtccccgtgagcatagctcaattggcagcgacaatgcattgttatatgc |
29658326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 45 - 89
Target Start/End: Original strand, 30566499 - 30566543
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatg |
89 |
Q |
| |
|
|||||||| |||| || ||||||||||||||| |||||||||||| |
|
|
| T |
30566499 |
cccgtgagcatagctcggttggcagggacaatgcattgttatatg |
30566543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 38363153 - 38363200
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||||||| |||||||| || |||||||||||||||| |
|
|
| T |
38363153 |
gtccccgtgagcatagttcaattggcaggaac-atacattgttatatgc |
38363200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 38451856 - 38451904
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||| ||||| |||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
38451856 |
gtccctgtgagcatagctcagttgacagggacaatgcattgttatatgc |
38451904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 14012605 - 14012653
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14012605 |
gtccccgtgagcatagttcagttggcagggacaatgcattgttatatgc |
14012653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 2800012 - 2800060
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
2800012 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
2800060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 10292345 - 10292393
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
10292345 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
10292393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 216245 - 216201
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
216245 |
cccgtgagcatagctcagttggcagggac-atacattgttatatgc |
216201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 692805 - 692761
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
692805 |
cccgtgagcatagctcagttggcagggac-atacattgttatatgc |
692761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 697014 - 696970
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
697014 |
cccgtgagcatagctcagttggcagggac-atacattgttatatgc |
696970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 729868 - 729824
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
729868 |
cccgtgagcatagctcagttggcagggac-atacattgttatatgc |
729824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 853763 - 853719
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
853763 |
cccgtgagcatagctcagttggcagggac-atacattgttatatgc |
853719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 2696526 - 2696574
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
2696526 |
gtccccgtgagcataactcagttggcagggacaatgcattattatatgc |
2696574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 14011139 - 14011092
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
14011139 |
gtccctgtgagcatagttcagttggcagggac-atgcattgttatatgc |
14011092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 38790675 - 38790627
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
38790675 |
gtccccgtgagcataactcagttggcagggacaatgcattattatatgc |
38790627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 9963409 - 9963457
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
9963409 |
gtccccgtgagtatagctcagttggcagggacaatgcattgttatatgc |
9963457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 6806742 - 6806694
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
6806742 |
gtccccgtgagcatagctcagttggcagagacaatgcattgttatatgc |
6806694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 3102229 - 3102182
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatg |
89 |
Q |
| |
|
|||||||| || |||| |||||||||||||||||| |||||||||||| |
|
|
| T |
3102229 |
gtccccgtaagcatagctcagttggcagggacaatgcattgttatatg |
3102182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 88
Target Start/End: Complemental strand, 3536037 - 3535992
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatat |
88 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
3536037 |
gtccccgtgagcatagttcagttggcagggac-atgcattgttatat |
3535992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 37417228 - 37417183
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
37417228 |
cccgtgagcttagctcagttggcagggacaatacattattatatgc |
37417183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 1463864 - 1463912
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
1463864 |
gtccctgtgagcatagctcagttggcagggacaatgcattattatatgc |
1463912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 30733113 - 30733161
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| ||| |||||||| |
|
|
| T |
30733113 |
gtccctgtgagtatagctcagttggcagggacaatgtattattatatgc |
30733161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 37303927 - 37303975
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||| |||||||| |
|
|
| T |
37303927 |
gtccccgtgagcatagctcagttggcagggacaatgtattattatatgc |
37303975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 43774178 - 43774226
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
43774178 |
gtccccgtgagtatagctcagttggcagggacaatgcattgttatatgc |
43774226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 41767870 - 41767822
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
41767870 |
gtccccgtgagcatagttcagttggcaggaacaatgcattgttatatgc |
41767822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 9624976 - 9625024
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
9624976 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
9625024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 14868678 - 14868726
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
14868678 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
14868726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 27183783 - 27183735
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
27183783 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
27183735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 38555129 - 38555081
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||| |||| |||||||| |
|
|
| T |
38555129 |
gtccccgtgagcatagttcagttggcagagacaatgcattattatatgc |
38555081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 47191366 - 47191414
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
47191366 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
47191414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 88
Target Start/End: Original strand, 10959126 - 10959172
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatat |
88 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||| |
|
|
| T |
10959126 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatat |
10959172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 16874291 - 16874244
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
16874291 |
gtccccgtgagcatagctcagttggcagggac-atgcattgttatatgc |
16874244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 24130553 - 24130600
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
24130553 |
gtccccgtgagcataactcagttggcagggac-atacattgttatatgc |
24130600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 39298069 - 39298021
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||| |||||||| |||| |||||||| |
|
|
| T |
39298069 |
gtccccgtgagcatagctcagttggcggggacaatgcattattatatgc |
39298021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 2945589 - 2945637
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
2945589 |
gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgc |
2945637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 41 - 88
Target Start/End: Original strand, 4078654 - 4078701
Alignment:
| Q |
41 |
ggtccccgtgagtatagttcagttggcagggacaatacattgttatat |
88 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
4078654 |
ggtccccgtgagcatagttcagttggcatggacaatgcattgttatat |
4078701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 9064859 - 9064907
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
9064859 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
9064907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 14981804 - 14981756
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
14981804 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
14981756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 6143958 - 6144005
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatg |
89 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| ||||||| |
|
|
| T |
6143958 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatg |
6144005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 87
Target Start/End: Original strand, 3448345 - 3448390
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttata |
87 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||| |||||||||| |
|
|
| T |
3448345 |
gtccccgtgagcatagctcaattggcagggacaatgcattgttata |
3448390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 130
Target Start/End: Complemental strand, 12311492 - 12311416
Alignment:
| Q |
53 |
tatagttcagttggcagggacaatacattgttatatgcgagagccgtggattcgaaacccaaaaatctcacttattca |
130 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| | || ||||||||| |||||| |||||||||||||| |
|
|
| T |
12311492 |
tatagctcagttggcagggacaatacattattatatgtagttgtcg-ggattcgaatcccaaacatctcacttattca |
12311416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 5134536 - 5134488
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||| || |||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
5134536 |
gtccccgtaagcatagctcagttggcagagacaatgcattgttatatgc |
5134488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 10455736 - 10455783
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| ||||||||||||||||| || || ||||||||||||| |
|
|
| T |
10455736 |
gtccccgtgagcatagttcagttggcaggaac-atgcattgttatatgc |
10455783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 28970161 - 28970209
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| |||||||||||| |
|
|
| T |
28970161 |
gtccccgtgagcgtagctcagttggcagggacaatgtattgttatatgc |
28970209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 30833011 - 30833058
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
30833011 |
gtccccatgagcatagttcagttggcagggac-atgcattgttatatgc |
30833058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 34524869 - 34524916
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
34524869 |
gtccccgtgagcatagctcagttggcagggac-atgcattgttatatgc |
34524916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 18)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 36008268 - 36008316
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
36008268 |
gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgc |
36008316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 48512192 - 48512240
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
48512192 |
gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgc |
48512240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 48968312 - 48968264
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
48968312 |
gtccccgtgagcatagttcagttggcagggacaatgcattattatatgc |
48968264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 2565254 - 2565302
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
2565254 |
gtccccgtgagcatagctcagttgacagggacaatgcattgttatatgc |
2565302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 12820507 - 12820459
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
12820507 |
gtccccgtgagcatagctcagttggcagagacaatgcattgttatatgc |
12820459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 28520833 - 28520785
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
28520833 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
28520785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 30152121 - 30152169
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
30152121 |
gtccccgtgagcatagctcagttggcaggaacaatgcattgttatatgc |
30152169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 53815689 - 53815737
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
53815689 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
53815737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 46 - 89
Target Start/End: Complemental strand, 4060023 - 4059980
Alignment:
| Q |
46 |
ccgtgagtatagttcagttggcagggacaatacattgttatatg |
89 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
4060023 |
ccgtgagtatagttcagttggcaggaacaataaattattatatg |
4059980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 41 - 88
Target Start/End: Original strand, 40150465 - 40150512
Alignment:
| Q |
41 |
ggtccccgtgagtatagttcagttggcagggacaatacattgttatat |
88 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||| |||| |||||| |
|
|
| T |
40150465 |
ggtccccgtgagcatagttcagttggcaggaacaatgcattattatat |
40150512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 90
Target Start/End: Original strand, 9084759 - 9084800
Alignment:
| Q |
49 |
tgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
9084759 |
tgagcatagctcagttggcagggacaatgcattgttatatgc |
9084800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 9692955 - 9693003
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||| ||| |||| |||||||| |
|
|
| T |
9692955 |
gtccccgtgagcatagctcagttggcagggataatgcattattatatgc |
9693003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 14149786 - 14149834
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
14149786 |
gtccccgtgaccatagctcagttggcagggacaatgcattattatatgc |
14149834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 90
Target Start/End: Original strand, 31480276 - 31480312
Alignment:
| Q |
54 |
atagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
31480276 |
atagctcagttggcagggacaatgcattgttatatgc |
31480312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 42411556 - 42411508
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||| |||||||| |
|
|
| T |
42411556 |
gtccccgtgagcatagctcagttggcagggacaatgcataattatatgc |
42411508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 46799401 - 46799449
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||||| |||||||||| ||||| |||| |||||||| |
|
|
| T |
46799401 |
gtccccgtgagcatagtttagttggcaggcacaatgcattattatatgc |
46799449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 49039546 - 49039499
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
49039546 |
gtccccgtgagcatagctcagttggcagggac-atgcattgttatatgc |
49039499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 56531338 - 56531290
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||| ||||| |||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
56531338 |
gtccctgtgagcatagctcagttggcaaggacaatgcattgttatatgc |
56531290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000007; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 34034344 - 34034392
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
34034344 |
gtccccgtgagcatagctcagttggcagggacaatacattattatatgc |
34034392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 11133069 - 11133117
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
11133069 |
gtccccgtgagcatagctcagttggtagggacaatgcattgttatatgc |
11133117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 29664596 - 29664644
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
29664596 |
gtccccgtgagcatagctcaattggcagggacaatgcattgttatatgc |
29664644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 42 - 85
Target Start/End: Original strand, 3955905 - 3955948
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgtta |
85 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
3955905 |
gtccccgtgagtttatttcagttggcaaggacaatacattgtta |
3955948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 45 - 91
Target Start/End: Original strand, 2935813 - 2935859
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatgcg |
91 |
Q |
| |
|
|||||||| |||| |||||||||||| ||||| |||||||||||||| |
|
|
| T |
2935813 |
cccgtgagcatagctcagttggcaggaacaatgcattgttatatgcg |
2935859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 1244563 - 1244610
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||| |||||| |||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
1244563 |
gtcctcgtgagcatagttcagttggcagggac-atacattgctatatgc |
1244610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 21970541 - 21970493
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||| |||| |||||||| |
|
|
| T |
21970541 |
gtccccgtgagcatagctcagttgacagggacaatgcattattatatgc |
21970493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 29034969 - 29035017
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||| |||| |||||||| |
|
|
| T |
29034969 |
gtccccgtgagcatagctcacttggcagggacaatgcattattatatgc |
29035017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 34376540 - 34376583
Alignment:
| Q |
46 |
ccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||| |
|
|
| T |
34376540 |
ccgtgagtataattcagttggcagggac-atgcattgttatatgc |
34376583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 41196044 - 41195996
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||| |||||| ||| ||||||||||||| |
|
|
| T |
41196044 |
gtccccgtgagcatagctcagttgacagggataatgcattgttatatgc |
41195996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 44187701 - 44187745
Alignment:
| Q |
46 |
ccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
44187701 |
ccgtgagcatagttcagttggcagggataatgcattattatatgc |
44187745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 14)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 9527419 - 9527467
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
9527419 |
gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgc |
9527467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 17350054 - 17350102
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
17350054 |
gtccccgtgagtatagctcagttggcagggacaatgcattattatatgc |
17350102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 29491463 - 29491511
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
29491463 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
29491511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 39238709 - 39238757
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
39238709 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
39238757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 40678816 - 40678864
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
40678816 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
40678864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 25819178 - 25819225
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatg |
89 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| ||||||| |
|
|
| T |
25819178 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatg |
25819225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 47763484 - 47763439
Alignment:
| Q |
45 |
cccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
47763484 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgc |
47763439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 2052784 - 2052736
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| | |||||| |
|
|
| T |
2052784 |
gtccccgtgagcatagctcagttggcagggacaatgcattatcatatgc |
2052736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 7906427 - 7906380
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| || ||||||||||||| |
|
|
| T |
7906427 |
gtccccgtgagcatagttcagttggtagggac-atgcattgttatatgc |
7906380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 9768910 - 9768863
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
9768910 |
gtccccgtgagcatagctcagttggcagggac-atgcattgttatatgc |
9768863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 18003810 - 18003857
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
18003810 |
gtccccgtgagcatagctcagttggcagggac-atgcattgttatatgc |
18003857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 19976654 - 19976606
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| || ||||||||| |
|
|
| T |
19976654 |
gtccccgtgagcatagctcagttggcagggacaatgtatggttatatgc |
19976606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 38021245 - 38021293
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||||| |||| |||||||| |
|
|
| T |
38021245 |
gtccccgtgagcatagctcagttggcaaggacaatgcattattatatgc |
38021293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 90
Target Start/End: Complemental strand, 47939288 - 47939252
Alignment:
| Q |
54 |
atagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
47939288 |
atagctcagttggcagggacaatgcattgttatatgc |
47939252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2098 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold2098
Description:
Target: scaffold2098; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 715 - 668
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatg |
89 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
715 |
gtccctgtgagtatagctcagttggcagggacaatgcattgttatatg |
668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 90
Target Start/End: Original strand, 25018 - 25067
Alignment:
| Q |
41 |
ggtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
25018 |
ggtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
25067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 4907 - 4859
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
4907 |
gtccccgtgagcatagctcagttggcagggacaatgcattattatatgc |
4859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0247 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0247
Description:
Target: scaffold0247; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 90
Target Start/End: Original strand, 20729 - 20764
Alignment:
| Q |
54 |
atagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20729 |
atagttcagttggcagggac-atacattgttatatgc |
20764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 34134 - 34087
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
34134 |
gtccccgtgagcatagctcagttggcagggac-atgcattgttatatgc |
34087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0112 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0112
Description:
Target: scaffold0112; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 18033 - 17985
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||||||||| |||| ||| |||| ||||||||| ||||||||||||| |
|
|
| T |
18033 |
gtccccgtgagcatagctcaattggtagggacaatgcattgttatatgc |
17985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 12558 - 12606
Alignment:
| Q |
42 |
gtccccgtgagtatagttcagttggcagggacaatacattgttatatgc |
90 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
12558 |
gtccctgtgagcatagctcagttggcagggacaatgcattattatatgc |
12606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University