View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17864_high_24 (Length: 227)

Name: NF17864_high_24
Description: NF17864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17864_high_24
NF17864_high_24
[»] chr8 (1 HSPs)
chr8 (19-217)||(3688439-3688637)


Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 3688637 - 3688439
Alignment:
19 tttcatattgttgcggcggttgaacaacctgaaacggtgtcatccaagaaacaacaccgtcaacaatctccgtcttctcccttttaaacacctgctcaca 118  Q
    ||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||    
3688637 tttcatattgttgcggccgttgaacaacctgtaacggtgtcatccacgaaacaacaccgtcaacaatatccgtcttctcccttttaaacacctgctcaca 3688538  T
119 ttccggcttcaggtctccggtctcgagacatgtctctcttttctgcactctttttctcttcacctccattctcctcaatgcttgaatctcacgtttcat 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3688537 ttccggcttcaggtctccggtctcgagacatgtctctcttttctgcactctttttctcttcacctccattctcctcaatgcttgaatctcacgtttcat 3688439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University