View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17864_low_10 (Length: 425)

Name: NF17864_low_10
Description: NF17864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17864_low_10
NF17864_low_10
[»] chr5 (1 HSPs)
chr5 (294-359)||(36819220-36819285)


Alignment Details
Target: chr5 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 294 - 359
Target Start/End: Original strand, 36819220 - 36819285
Alignment:
294 ataaatatgggaaacatttaaaaatattgaatgaccaaattgaaatattcataccattactatctc 359  Q
    ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
36819220 ataaacatgggaaacatttaaaaatattgactgaccaaattgaaatattcataccattactatctc 36819285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University