View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17864_low_16 (Length: 381)
Name: NF17864_low_16
Description: NF17864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17864_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 77 - 355
Target Start/End: Complemental strand, 55878499 - 55878221
Alignment:
| Q |
77 |
gttgagacacattgcataccttaattctcatcttttatctctttctcggccacgtctcgcggcgtgggtggtgcgcgaccaagctgccaattgtgtgact |
176 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |||| || | |||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
55878499 |
gttgtgacacattgcataccttaattctcatctttaatctctttctcagccatgtattgcggtgtgggtggtgcgcggccaagctgccagttgtgtgact |
55878400 |
T |
|
| Q |
177 |
tgcatggagataaccttcaactcctccctgcaatgcaaaaactggaagaaccacacgatattttaggccttatgaagtgaaaagttttggaaatatttag |
276 |
Q |
| |
|
|||| || |||||||||| ||||||||||||||||| |||||||||||||||||| |||||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
55878399 |
ggcattgaaataaccttcatctcctccctgcaatgcacaaactggaagaaccacacagtattttcggccttacaaagtgaaaagttttggaaatctttag |
55878300 |
T |
|
| Q |
277 |
tctttgggaaagtgaccttagttttaagaggttttgatatcacaactccacaccacctataaaaactatacagtcccaa |
355 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55878299 |
tctttgggaaagtgaccttagttttaaaagcctttgatatcacaactccacaccacctataaaaactatacagtcccaa |
55878221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University