View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17864_low_25 (Length: 229)
Name: NF17864_low_25
Description: NF17864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17864_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40224537 - 40224317
Alignment:
| Q |
1 |
tttatgctgcagtcatggccgaaattagccgtgaagaattggcttagtacaaagaacagttctgaaaagtttacctcagattattctgttacaggtgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224537 |
tttatgctgcagtcatggccgaaattagccgtgaagaattggcttagtacaaagaacagttctgaaaagtttacctcagattattctgttacaggtgaaa |
40224438 |
T |
|
| Q |
101 |
ctcaattattttaattaagattgtgattggttttctttgagtttggtttcattttacgtttttcgtgttgaaattgagacattattttgtttaatctttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224437 |
ctcaattattttaattaagattgtgattggttttctttgagtttggtttcattttacgtttttcgtgttgaaattgagacattattttgtttaatctttg |
40224338 |
T |
|
| Q |
201 |
tgggactcacacaggttctgc |
221 |
Q |
| |
|
|||||||||| |||| ||||| |
|
|
| T |
40224337 |
tgggactcactcagggtctgc |
40224317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University