View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17864_low_26 (Length: 228)
Name: NF17864_low_26
Description: NF17864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17864_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 45999557 - 45999756
Alignment:
| Q |
18 |
attctgggatagaaatttgacatttggtagcaaatgttagcagttacttatgagtattcaagcattcaccttcgttagaaattccatgagtttcaacttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45999557 |
attctgggatagaaatttgacatttggtagcaaacgttagcggttacttatgagtattcaagcattcaccttcgttagaatttccatgagtttcaacttt |
45999656 |
T |
 |
| Q |
118 |
caattaactctactttccatttatataaacgaatattgcaccatggtatatttcttaccatgtgcctatcatattcatattctgtctctatcctttgcta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45999657 |
caattaactctactttccatttatataaacgaatattgcaccatggtttatttcttaccatgtgcctatcatattcatattctgtctctatccattgcta |
45999756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 98 - 184
Target Start/End: Original strand, 44936948 - 44937032
Alignment:
| Q |
98 |
attccatgagtttcaactttcaattaactctactttccatttatataaacgaatattgcaccatggtatatttcttaccatgtgcct |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| ||||||| ||| || ||||||||||||||||| |||||| |||| ||||||| |
|
|
| T |
44936948 |
attccaggagtttcaactttcaattaaccctaccttccatt--tatcaatgaatattgcaccatggtttatttcctaccttgtgcct |
44937032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University