View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17866_high_11 (Length: 344)
Name: NF17866_high_11
Description: NF17866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17866_high_11 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 121 - 328
Target Start/End: Complemental strand, 30148925 - 30148718
Alignment:
| Q |
121 |
attagctctatcactatgatccttctttaacaccaagttgcttcaaaacttggataagttcatccaactctttagaggaaactccacccttactcacagc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30148925 |
attagctctatcactatgatccttctttaacaccaagttgcttcaaaacttggataagttcatccaactctttagaggaaactccacccttactcacagc |
30148826 |
T |
|
| Q |
221 |
cccaacaacttcctctctcatcgacttagctcttctcttttggtgactatccccactcataacacctgaaactacccgaccgagaacatctggatccggc |
320 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30148825 |
cccaacaacttcctctctcatcaacttagctcttctcttttggggactatccccagtcataacacctgaaactacccgaccgagaacatctggatttggc |
30148726 |
T |
|
| Q |
321 |
acagaatc |
328 |
Q |
| |
|
|||||||| |
|
|
| T |
30148725 |
acagaatc |
30148718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 11 - 92
Target Start/End: Complemental strand, 30149035 - 30148954
Alignment:
| Q |
11 |
cacagagggactattggtctctctaatatcactacagagaaatacttacttgatcaccagaccaaatatatagtaattaggc |
92 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30149035 |
cacacagggactattggtctctctaatatcactacagagaaatacttacttgatcacaagaccaaatatatagtaattaggc |
30148954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 132 - 282
Target Start/End: Original strand, 140715 - 140865
Alignment:
| Q |
132 |
cactatgatccttctttaacaccaagttgcttcaaaacttggataagttcatccaactctttagaggaaactccacccttactcacagccccaacaactt |
231 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| | |||| |||||||| |||||||||||||||||| ||| ||||||||||||||| || | ||| |
|
|
| T |
140715 |
cactatgatctttctttaacaccaagttgctgcaaagcatggacaagttcattcaactctttagaggaaacaccatccttactcacagccctaagagctt |
140814 |
T |
|
| Q |
232 |
cctctctcatcgacttagctcttctcttttggtgactatccccactcataa |
282 |
Q |
| |
|
||||| ||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
140815 |
cctctttcatcaacttagctcttttcttttgtggactatccccactcataa |
140865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University