View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17866_high_6 (Length: 432)
Name: NF17866_high_6
Description: NF17866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17866_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 418; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 418; E-Value: 0
Query Start/End: Original strand, 1 - 430
Target Start/End: Original strand, 42431718 - 42432147
Alignment:
| Q |
1 |
cccgttaatcacagacccaagctcttccttaatccctctaacagcagcagattccggatcctcattcggcttcatcttctccgacaacggcctaccccgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42431718 |
cccgttaatcacagacccaagctcttccttaatccctctaacagcagcagattccggatcctcattcggcttcatcttctccgacaacggcctaccccgt |
42431817 |
T |
|
| Q |
101 |
tccctcactttcccatcagacaattcctgatgcgattccacaagaattttaccgtctttccccacaacccgaaccgtaacaacctgaacggttcgaactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42431818 |
tccctcactttcccatcagacaattcctgatgcgattccacaagaattttaccgtctttccccacaacccgaaccgtaacaacctgaacggttcgaactg |
42431917 |
T |
|
| Q |
201 |
gaggttcagaatcatcaagcgaggtttctccctgagatagttcaagccaaagattgtgaacgttcttcgttccgggcttaacaccccacgtggcgaagga |
300 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42431918 |
gaggttcggaatcatcaagcgaggtttctccctgagatagttcaagccaaagattgtgaacgttcttcgttccgggcttaacaccccacgtggcgaagga |
42432017 |
T |
|
| Q |
301 |
atctgaaggtaaacgaggtttaagccattcagaaagagattgcggagatacgaaattgcgacggttatttctgttagggtttgaggaggaggatgatgat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42432018 |
atctgaaggtaaacgaggtttaagccattcagaaagagattgcggagatacgaaattgcgacggttatttctgttagggtttgaggaggaggatgatgat |
42432117 |
T |
|
| Q |
401 |
aacgatgaggtggatatattcttggacatg |
430 |
Q |
| |
|
||||||||||||||||| || ||||||||| |
|
|
| T |
42432118 |
aacgatgaggtggatatgttgttggacatg |
42432147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University