View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17866_low_10 (Length: 382)

Name: NF17866_low_10
Description: NF17866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17866_low_10
NF17866_low_10
[»] chr3 (1 HSPs)
chr3 (255-365)||(53538458-53538568)


Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 255 - 365
Target Start/End: Original strand, 53538458 - 53538568
Alignment:
255 aatgatagtgctgattttcaatagtgagctctgccatctaattctaaccctcatcatatgattgttggagcctttgatcaagtgaggacatggagcctac 354  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
53538458 aatgatagtgctgattttcaatagtgagctctgccatctaattctaaccctcatcatatgattgttgaagcctttgatcaagtgaggacatggagcctac 53538557  T
355 atggtcaccta 365  Q
    |||||||||||    
53538558 atggtcaccta 53538568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University