View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17866_low_10 (Length: 382)
Name: NF17866_low_10
Description: NF17866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17866_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 255 - 365
Target Start/End: Original strand, 53538458 - 53538568
Alignment:
| Q |
255 |
aatgatagtgctgattttcaatagtgagctctgccatctaattctaaccctcatcatatgattgttggagcctttgatcaagtgaggacatggagcctac |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53538458 |
aatgatagtgctgattttcaatagtgagctctgccatctaattctaaccctcatcatatgattgttgaagcctttgatcaagtgaggacatggagcctac |
53538557 |
T |
|
| Q |
355 |
atggtcaccta |
365 |
Q |
| |
|
||||||||||| |
|
|
| T |
53538558 |
atggtcaccta |
53538568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University