View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17866_low_15 (Length: 321)
Name: NF17866_low_15
Description: NF17866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17866_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 40 - 306
Target Start/End: Original strand, 1184622 - 1184888
Alignment:
| Q |
40 |
ctttctttcacaaaacagtgagagagtatataatatggtcacactttcacagcacgcattgaaattctatagcttccacgttgttgtgatgcttctcttt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1184622 |
ctttctttcacaaaacagtgagagagtatataatatggtcacacttttacaccacgcattgaaattctatagcttccacgttgttgtcatgcttctcttt |
1184721 |
T |
|
| Q |
140 |
tgcatcttcctcgcctactttctttatttgaaactgttggttaatcacgtcttcaatactctctttattttcatccaaaggaattggaaacacttctgaa |
239 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1184722 |
tgcatcttcctcacctactttctttacttgaaattgttggttaatcacgtcttcaatactctctttattttcatccaaaggaattggaaacacttctgaa |
1184821 |
T |
|
| Q |
240 |
gaccctaacgggttcacaacaacaatgtttatcactgcttgctccttctccttctcaacaccatatt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1184822 |
gaccctaacgggttcacaacaacaatgtttatcactgcttgctccttctccttctcaacactatatt |
1184888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University