View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17867_low_12 (Length: 236)
Name: NF17867_low_12
Description: NF17867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17867_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 50 - 220
Target Start/End: Complemental strand, 7881170 - 7881000
Alignment:
| Q |
50 |
aattatcattggtttgtctaaagaattttgtcattagttttgtatacgtcgaattttaacggtagaaaataaatggctcattttgtgttttcttcttttg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7881170 |
aattatcattggtttgtctaaagaattttgttattagttttgtatacgtcgaattttaacggtagaaaataaatggctcaatttgtgttttcttcttttg |
7881071 |
T |
 |
| Q |
150 |
cttatttaatatatcttggaccccacaaaaattgtctcttcctgcatgattggaatacgtacaccaataat |
220 |
Q |
| |
|
||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7881070 |
cttttttaatatatcttggaccccacaaaaaatgtctcttcctgcatgattggaatacgtacaccaataat |
7881000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 7881236 - 7881191
Alignment:
| Q |
18 |
atattagcctatacatattgtagaagtttaataattatcattggtt |
63 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7881236 |
atattagcctatacatattatagaagtttaataattatcattggtt |
7881191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University