View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17867_low_13 (Length: 236)
Name: NF17867_low_13
Description: NF17867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17867_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 46354647 - 46354447
Alignment:
| Q |
15 |
aaatttaaaacacatcttattgttcataccataacttatggaaatacgtctccataatgtgagtcattataattttatccttgataaaatacgtcttatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46354647 |
aaatttaaaacacatcttattgttcataccataacttatggaaatacgtctctataatgtgattcattataattttatccttgataaaatacgtcttatt |
46354548 |
T |
 |
| Q |
115 |
agttttgacttgaaagcaacgttagtaccttgatatactgaatcaataaaatgtaaaaattgagctatatatttttatcatcaaaatataaacacgtcca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46354547 |
agttttgacttgaaagcaacgttagtaccgtgatatactgaatcaataaaatgtaaaaattgagctatatatttttatcatcaaaatataaacacgtcca |
46354448 |
T |
 |
| Q |
215 |
a |
215 |
Q |
| |
|
| |
|
|
| T |
46354447 |
a |
46354447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University