View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17869_low_16 (Length: 250)
Name: NF17869_low_16
Description: NF17869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17869_low_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 1176697 - 1176460
Alignment:
| Q |
13 |
attctactgcactaccatctatggtctacaatacatgtggtaatttttactctaaaatttgattgaaaatacttttatcaggnnnnnnnaggtgaaactg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
1176697 |
attctactgcactaccatctatggtctaaaatacatgtggtaatttttactccaaaatttgattgaaaatacttttatcaggtttttttaggtgaaaatg |
1176598 |
T |
 |
| Q |
113 |
ggggatgtgacatggatggaaatgaattgccacgtttggtgtatgtttctagagaaaagaggcctaacttcaatcaccnnnnnnnngcaggagctctaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1176597 |
ggggatgtgacatggatggaaatgaattgccacgtttggtgtatgtttctagagaaaagaggcctaacttcaatcaccaaaaaaaagcaggagctctaaa |
1176498 |
T |
 |
| Q |
213 |
tgcactggtaagcaatacctatgaatgagtatgcgatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1176497 |
tgcactggtaagcaatacctatgaatgagtatgcgatt |
1176460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University