View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17869_low_17 (Length: 239)
Name: NF17869_low_17
Description: NF17869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17869_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 11 - 195
Target Start/End: Complemental strand, 4680476 - 4680293
Alignment:
| Q |
11 |
agaagcaaaggatgtatggctcaagaataaaagttgattgtacaaatcaatacattagattacacaaaacttgtctattgttacaacaaaacaacccacc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680476 |
agaaacaaaggatgtatggctcaagaataaaagttgattgtacaaatcaatacattagattacacaaaacttgtctattgttacaacaaaacaacccacc |
4680377 |
T |
 |
| Q |
111 |
ctgacgtttattgtccaaagagaaaataactgggacacacgactaatgatgagaccaaaattgaataatagttttgttcactatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4680376 |
ctgacgtttattgtccaaagagaaaataactgggacacacgactaatgatgagaccaaaattgaataatag-tttgttcactatg |
4680293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University