View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17869_low_18 (Length: 237)
Name: NF17869_low_18
Description: NF17869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17869_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 15916018 - 15916238
Alignment:
| Q |
18 |
ggtttgggtcagaggtctttatagctccatccaaatcgtttattttttcgagggtagcctacaacaaacttcctacatatgaaaatttgagaatgaaggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15916018 |
ggtttgggtcagaggtctttatagctccatccaaatcgtttattttttcgagggtagcctacaacaaacttcctacatatgaaaatttgagaatgaaggt |
15916117 |
T |
 |
| Q |
118 |
aagctgcatagtctcaatatgttgcttttgt-nnnnnnntcattatgagacctcaaaccatattttctgtaattgtcctgtaacttttcagctaagggat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15916118 |
aagctgcatagtctcaatatgttgcttttgtaaaaaaaatcattatgagacctcaaaccatattttctgcaattgtcctgtaacttttcagctaagggat |
15916217 |
T |
 |
| Q |
217 |
tagctcatgaaaggaacaaat |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
15916218 |
tagctcatgaaaggaacaaat |
15916238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University