View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17870_low_7 (Length: 435)
Name: NF17870_low_7
Description: NF17870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17870_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 7e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 13 - 140
Target Start/End: Complemental strand, 2442974 - 2442847
Alignment:
| Q |
13 |
tactgtaatttgtggcaatgaacgtttgatagaaaatgtagcaggggttatgaagaacatttagacgatgtagggagcagcttcagtcaaataaattagg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2442974 |
tactgtaatttgtggcaatgaacgtttgatagaaaatgtagcaggggttatgaagaacagtttgacgatgtagggagtagcttcagtcaaataaattagg |
2442875 |
T |
|
| Q |
113 |
ttttctatgtcataaatcttctataata |
140 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2442874 |
ttttctatgtcataaatcttctataata |
2442847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 348 - 418
Target Start/End: Complemental strand, 2435445 - 2435375
Alignment:
| Q |
348 |
ataatcaaatcagtggttgaggcaatccactcatatgtcatgaacatatttctcattcccactactattat |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2435445 |
ataatcaaatcagtggttgaggcaatccactcatatgtcaagaacatatttctcattcccactactattat |
2435375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University