View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17872_low_2 (Length: 381)
Name: NF17872_low_2
Description: NF17872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17872_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 18 - 371
Target Start/End: Complemental strand, 3744426 - 3744073
Alignment:
| Q |
18 |
gctacttttgacgcgataaatccttctacggaacgagctttgggctagcataattgatgattgataattcattgttcaaccatctcaggactatcaaata |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744426 |
gctacttatgacgcgataaatccttctacggaacgagctttgagctagcataattgatgattgataattcattgttcaaccatctcaggactatcaaata |
3744327 |
T |
|
| Q |
118 |
aatttataaaattatatatatttcaaaattttactgagtttgaagactaagctttgcacaagagaaagcacatgacatagatatagggacagtgatacat |
217 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
3744326 |
aatttatgaaattatagatatttcaaaattttactgagtttgaagactaagctttacacaagagaaagcacatggcatagatataggaacagtgatacat |
3744227 |
T |
|
| Q |
218 |
catttgggatgctacgggataaaacgtttttgctatgtttcaataatgctaaacatagcgttttatcccgaatgatgtgtcactgtttctatctatgcca |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3744226 |
catttgggatgctacgggataaaacgtttttgctatgtttcaataatgctaaacatagcgttttatcccgaatgatgtgtcactgtttcaatctatgcca |
3744127 |
T |
|
| Q |
318 |
tatgctttctcttgtgcaaagcttctctgttccatattccaaaaatcttctctg |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744126 |
tatgctttctcttgtgcaaagcttctctgttccatattccaaaaatcttctctg |
3744073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 341
Target Start/End: Original strand, 3744217 - 3744278
Alignment:
| Q |
282 |
atcccgaatgatgtgtcactgtttctat--ctatgccatatgctttctcttgtgcaaagctt |
341 |
Q |
| |
|
||||| |||||||| |||||||| |||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
3744217 |
atcccaaatgatgtatcactgttcctatatctatgccatgtgctttctcttgtgtaaagctt |
3744278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 306 - 349
Target Start/End: Complemental strand, 20196286 - 20196243
Alignment:
| Q |
306 |
ctatctatgccatatgctttctcttgtgcaaagcttctctgttc |
349 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||| ||||| |
|
|
| T |
20196286 |
ctatctatgccacatgctttctcttgtgcaaaacttctttgttc |
20196243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University