View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17873_high_28 (Length: 315)
Name: NF17873_high_28
Description: NF17873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17873_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 37727275 - 37726972
Alignment:
| Q |
1 |
aacaatataaatgtagttgttaagtatatccaagattggaatttaacgttttcactagcataacttctgcgggtattgaaacacattaactaaataaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37727275 |
aacaatataaatgtagttgttaagtatatccaagattggaatttaacgttttcactagcataacttctgcgggtattgaaacacattaactaaataaact |
37727176 |
T |
 |
| Q |
101 |
aaataagttagaccttctagctgctttcatgatgttcttgttgttgccgttgtttttgtcagtgttttagatttatggcgnnnnnnngtattgcagatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37727175 |
aaataagttagaccttctagctgctttcatgatgttcttgttgttg-cgttgtttttgtcagtgttttagatttatggcgtttttttgtattgcagatcc |
37727077 |
T |
 |
| Q |
201 |
atgtctggtttgtggttctgttacttagcatgcaaatttattcctttttgtctttcattcttttctggannnnnnnncctgaaattggaatccgatgtgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37727076 |
atgtctggtttgtggttctgttacttagcatgcaaatttattcctttttgtcttccattcttttctggattttttttcctgaaattggaatccgatgtgt |
37726977 |
T |
 |
| Q |
301 |
ttcat |
305 |
Q |
| |
|
||||| |
|
|
| T |
37726976 |
ttcat |
37726972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 198 - 269
Target Start/End: Original strand, 34809817 - 34809888
Alignment:
| Q |
198 |
tccatgtctggtttgtggttctgttacttagcatgcaaatttattcctttttgtctttcattcttttctgga |
269 |
Q |
| |
|
|||||| | ||||||||| ||||||| | |||||| |||||||||||||||||| | |||| ||||||||| |
|
|
| T |
34809817 |
tccatgaccggtttgtgggtctgttattgagcatgaaaatttattcctttttgttgtacatttttttctgga |
34809888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University