View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17873_high_30 (Length: 294)
Name: NF17873_high_30
Description: NF17873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17873_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 54 - 216
Target Start/End: Complemental strand, 42004534 - 42004373
Alignment:
| Q |
54 |
ttagcttgagataaaagagaaatggtgttaatcttgtacactactacttatcatgaacattcaaagttgtcacaaatttttattttatttcaattcaaat |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42004534 |
ttagcttgagataaaagagaaatggtgttaatcttgtacactactacttatcatgaacattcaaagttgtcacaa-tttttattttatttcaattcaaat |
42004436 |
T |
 |
| Q |
154 |
gaatcattccagcaaagcagacattatctttttgacataatccagcaggaacgtttctaactc |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
42004435 |
gaatcatcccagcaaagcagacattatctttttgacgtaatccagcaggaatgtttctaactc |
42004373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University