View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17873_high_34 (Length: 261)
Name: NF17873_high_34
Description: NF17873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17873_high_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 11 - 261
Target Start/End: Complemental strand, 29989727 - 29989473
Alignment:
| Q |
11 |
cataggcatctctcactagggtcaaatcccacttaattagacattgagattatgtcgttaataaaggtctttgttttagcggaaaacttcaatctaatta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29989727 |
cataggcatctctcactagggtcaaatcccacttaattagacattgagattgtgtcgttaataaaggtctttgttttagcggaaaacttcaatctaatta |
29989628 |
T |
 |
| Q |
111 |
ttttgtctaatattatttgtctatgcgatgataatattaatatgat-ccttgactaaaagaatgtatttatgtcatcaaaaaatataattaatttggtct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29989627 |
ttttgtctaatattatttgtctatgcgatgataatattaatatgatcccttgactaaaataatgtatttatgtcatccaaaaatataattaatttggtct |
29989528 |
T |
 |
| Q |
210 |
aatgtaaactgattcaagccctccaagcaaattcat---aaggttttaaaacttc |
261 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29989527 |
aatgtaaaatgattcaagccctccaagcaaattcataagaaggttttaaaacttc |
29989473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University