View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17873_high_38 (Length: 230)
Name: NF17873_high_38
Description: NF17873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17873_high_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 58 - 210
Target Start/End: Original strand, 35477483 - 35477632
Alignment:
| Q |
58 |
gacaataataggattaaaggcatatcataagaggattaaaggcatatcaaatatataattaccatgaactctttttcatggtaaataatttacattgttt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
35477483 |
gacaataataggattaaaggcatatcataagaggattaaaggcatatcaaatatataattaccatgaactctttttcattttaagaaa---acattgttt |
35477579 |
T |
 |
| Q |
158 |
tcgacaaagaaaacactgtttttgtcaacnnnnnnngttgttttgtttattaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35477580 |
tcgacaaagaaaacactgtttttgtcaacaaaaaaagttgttttgtttattaa |
35477632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 12 - 58
Target Start/End: Original strand, 35477408 - 35477454
Alignment:
| Q |
12 |
gagtagcataggggcattatatcggtcctcaaatttattttcctttg |
58 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35477408 |
gagtggcataggggcattatatcggtcctcaaatttcttttcctttg |
35477454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University