View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17873_high_40 (Length: 222)

Name: NF17873_high_40
Description: NF17873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17873_high_40
NF17873_high_40
[»] chr2 (1 HSPs)
chr2 (22-202)||(37727301-37727481)


Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 22 - 202
Target Start/End: Complemental strand, 37727481 - 37727301
Alignment:
22 gttgttttcttattcattcaaaacagttagtttgtcgaatacgtttccttctggaccttgatgaaaatttgactgccaaattctgtggctaatctccagc 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37727481 gttgttttcttattcattcaaaacagttagtttgtcgaatacgtttccttctggaccttgatgaaaatttgactgccaaattctgtggctaatctccagc 37727382  T
122 atacgnnnnnnnnnnaaggaatctccagcatacgttggaatcatatacttgaatgagaaatattttgcaatataaatgtag 202  Q
    |||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37727381 atacgttttttttttaaggaatctccagcatacgttggaatcatatacttgaatgagaaatattttgcaatataaatgtag 37727301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University