View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17873_low_31 (Length: 274)
Name: NF17873_low_31
Description: NF17873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17873_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 52 - 252
Target Start/End: Complemental strand, 41697738 - 41697538
Alignment:
| Q |
52 |
ctggggagcttccaagctctgcatttgcatttaatagcaatggattggtaaaaattccctattatttcaaatgatctcttaatattaaagtaagtattaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697738 |
ctggggagcttccaagctctgcatttgcatttaatagcaatggattggtaaaaattccctattatttcaaatgatctcttaatattaaagtaagtattaa |
41697639 |
T |
|
| Q |
152 |
gaacaaaattttctttatgatcattaggcattcactctaaattcagtaccaccagctgaagatgaaattgtagctggtgggattgggcgcaacttcattt |
251 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697638 |
gaacaaaatttgctttatgatcattaggcattcactctaaattcagtaccaccagctgaagatgaaattgtagctggtgggattgggcgcaacttcattt |
41697539 |
T |
|
| Q |
252 |
c |
252 |
Q |
| |
|
| |
|
|
| T |
41697538 |
c |
41697538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University