View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17873_low_33 (Length: 265)
Name: NF17873_low_33
Description: NF17873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17873_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 15 - 171
Target Start/End: Original strand, 4699016 - 4699171
Alignment:
| Q |
15 |
taaagaacaattataaaacaaggactaaataactatgaacaacagttccaacactgtagaagccttttcagcgggttctttgttgattttgcagccgcca |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4699016 |
taaagaacaat-ataaaacaaggactaaataactatgaacaacagttccaacactgtagaagccttttcagcgggttctttgttgattttgcagcagcca |
4699114 |
T |
|
| Q |
115 |
ttttttcattcttctgttggttcatcctttcatcagctgcagccctctctctggcct |
171 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| | |||| |||||| |
|
|
| T |
4699115 |
tttcttcattcttctgttggttcatcctttcatcagctgcagctcgctctttggcct |
4699171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 121 - 171
Target Start/End: Complemental strand, 39420805 - 39420755
Alignment:
| Q |
121 |
cattcttctgttggttcatcctttcatcagctgcagccctctctctggcct |
171 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
39420805 |
cattcttctgttggttcatccttgcagaagctgcagccctctctctggcct |
39420755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University