View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17875_low_9 (Length: 237)
Name: NF17875_low_9
Description: NF17875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17875_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 32 - 213
Target Start/End: Original strand, 4744375 - 4744559
Alignment:
| Q |
32 |
aaaagtgacttgtcttataaagaaaaatttaatataagaataagcata-ttagtatgatattattcaatgtgtt--gtaggatgttgctgggcattttca |
128 |
Q |
| |
|
||||||||||||||| || |||||||| ||||| |||||||||||||| ||||||||||||||||| || |||| ||||||||||| |||||||||||| |
|
|
| T |
4744375 |
aaaagtgacttgtctaatcaagaaaaaattaatttaagaataagcataattagtatgatattattcgatatgttttgtaggatgttgttgggcattttca |
4744474 |
T |
|
| Q |
129 |
gctgtggcagctgtagaaggtgctgtgaaaatcaacactggtcatttgatctcattatcagagcaacaattggttgactgtgatg |
213 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4744475 |
gtcgtggctgctgtagaaggtgctgtgaaaatcaacactggcgagttgatctcattatctgagcaacaattggttgactgtgatg |
4744559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 98 - 212
Target Start/End: Original strand, 4735930 - 4736044
Alignment:
| Q |
98 |
atgtgttgtaggatgttgctgggcattttcagctgtggcagctgtagaaggtgctgtgaaaatcaacactggtcatttgatctcattatcagagcaacaa |
197 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||| |||||||| ||||||||| ||||||||| || | |||| ||||||||||||| |||||||||||| |
|
|
| T |
4735930 |
atgtgttgtaggatgttgttgggcttttacagccgtggcagccgtagaaggtattgtgaaaataaaaaatggtaatttgatctcattgtcagagcaacaa |
4736029 |
T |
|
| Q |
198 |
ttggttgactgtgat |
212 |
Q |
| |
|
|| ||||| |||||| |
|
|
| T |
4736030 |
ttagttgattgtgat |
4736044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University