View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17876_high_14 (Length: 286)
Name: NF17876_high_14
Description: NF17876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17876_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 13 - 267
Target Start/End: Complemental strand, 35205630 - 35205376
Alignment:
| Q |
13 |
gtagcataggcggagaatgtggatggtgctcgtgctgtattagaatgctcgggtttgtcattggttattgggattttgcaatctgcaaattcgagtgcgg |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35205630 |
gtagcattggcggagaatgtggatggtgctcgtgctgtattagaatgctcgggtttgtcattggttattgggattttgcaatctgcaaattcgcgtgcgg |
35205531 |
T |
|
| Q |
113 |
agaaggagtactgtgtttccattttggtttcactatgtgttaatgttggtggagaggttgttagtgttttggcgaagcatgcttcggggattatgccttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205530 |
agaaggagtactgtgtttccattttggtttcactatgtgttaatgttggtggagaggttgttagtgttttggcgaagcatgcttcggggattatgccttt |
35205431 |
T |
|
| Q |
213 |
gctttatgcaaatcttaccgatggtactcctcaagcggagaagaaagcgcggaaa |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205430 |
gctttatgcaaatcttaccgatggtactcctcaagcggagaagaaagcgcggaaa |
35205376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University