View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17876_high_20 (Length: 261)
Name: NF17876_high_20
Description: NF17876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17876_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 238
Target Start/End: Original strand, 45096272 - 45096501
Alignment:
| Q |
9 |
gagaagaaggagacaagaaatggcagagagattcatacaactttcggctatgatacctggcttgaagaaggttagttcctgcttcttctttaatattcta |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45096272 |
gagaaaaaggagacaagaaatggcagagagattcatacaactttcggctatgatacctggcttgaagaaggttagttcctgcttcttctttaatattcta |
45096371 |
T |
 |
| Q |
109 |
tatatgcaccattctgttttttgtagatcaaaacatggaaatactaaatatagattaaacatgaggtttattatattaactttttataatggataggatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45096372 |
tatatgcaccattctgttttttgtagatcaaaacatggaaatactaaatatagattaaacatgaggtttattatattaactttttataatggataggttt |
45096471 |
T |
 |
| Q |
209 |
ctttgttttatactgttttagtggatatgc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45096472 |
ctttgttttatactgttttagtggatatgc |
45096501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University