View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17876_low_13 (Length: 299)
Name: NF17876_low_13
Description: NF17876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17876_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 276
Target Start/End: Complemental strand, 9297421 - 9297164
Alignment:
| Q |
19 |
atcagatcagtgcttatctagcagcagcactgctttttctttatcatcaaatcatcaccatagtcgataattacatcttcattacttgcacgcaaatgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9297421 |
atcagatcagtgcttatctagcagcagcactgctttttctttatcatcaaatcatcaccatagtcgataattacatcttcattacttgcacgcaaatgta |
9297322 |
T |
|
| Q |
119 |
tagttttcaaatatcaatgcaactcatgtatctaaatcaaactctataaagtcacaataattcttacactcttgaactatggcatcatcaattgtcatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9297321 |
tagttttcaaatatcaatgcaactcatgtatctaaatcaaactctataaagtcataataattcttacactcttgaattatggcatcatcaattgtcatga |
9297222 |
T |
|
| Q |
219 |
atgagttataattgttttaaaatttaaagtatatggtaaaccctcacattggcttgaa |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9297221 |
atgagttataattgttttaaaatttaaagtatatggtaaaccctcacattggcttgaa |
9297164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University