View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17876_low_23 (Length: 252)
Name: NF17876_low_23
Description: NF17876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17876_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 69 - 189
Target Start/End: Complemental strand, 42631466 - 42631346
Alignment:
| Q |
69 |
taatgtccttcaaaccatcttgacaacccaactcaatcgcacattcactttagaccttttaaccacaactccgttaaaacaagagaccaaaattgttgat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42631466 |
taatgtccttcaaaccatcttgacaacccaactcaatcacacattcactttagaccttttaaccacaactccgttaaaacaagagaccaaaattgttgat |
42631367 |
T |
 |
| Q |
169 |
taaaacataagggatcaataa |
189 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42631366 |
taaaacataagggatcaataa |
42631346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 64
Target Start/End: Complemental strand, 42631548 - 42631503
Alignment:
| Q |
19 |
agaagattgacatataaccacacaattaatctaatgatgattcatt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42631548 |
agaagattgacatataaccacacaattaatctaatgatgattcatt |
42631503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University