View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17876_low_25 (Length: 246)
Name: NF17876_low_25
Description: NF17876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17876_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 13 - 151
Target Start/End: Original strand, 32492805 - 32492943
Alignment:
| Q |
13 |
aatatcataaagaaagtttgtacccaaattgagtcgtcactcgtcaataattcacacgcaaaatattcttctcccagctcattggtgaaatggattataa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32492805 |
aatatcataaagaaagtttgtacccaaattgagtcgtcactcgtcaataattcacacgcaaaatattcttctcccagctcattggtgaaatggattataa |
32492904 |
T |
 |
| Q |
113 |
agctactagcaaatgatttagaaattagagagtatatgt |
151 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
32492905 |
agctactagcaattgatttagaaattagaaagtatatgt |
32492943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 147 - 188
Target Start/End: Original strand, 32493010 - 32493051
Alignment:
| Q |
147 |
tatgttgccctcttgtaatattcgcattgtattttattttat |
188 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32493010 |
tatgttgccctccactaatattcgcattgtattttattttat |
32493051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University